🌐 Mailman 3 December 2004 - Tutor - python.org

How to calculate pi with this formula?
by Dick Moores April 14, 2005

April 14, 2005

Is it possible to calculate almost-pi/2 using the (24) formula on <http://mathworld.wolfram.com/PiFormulas.html> without using (23)? If it's possible, how about a hint? Recursion? Thanks, tutors. Dick Moores rdm(a)rcblue.com

6 12

Matrix
by Bugra Cakir Jan. 13, 2005

Jan. 13, 2005

hi, I want to create a matrix in Python. For example 3x4 how can i create this? thanks

7 8

How to substitute an element of a list as a pattern for re.compile()
by kumar s Jan. 2, 2005

Jan. 2, 2005

Hi Group: I have Question: How can I substitute an object as a pattern in making a pattern. >>> x = 30 >>> pattern = re.compile(x) My situation: I have a list of numbers that I have to match in another list and write them to a new file: List 1: range_cors >>> range_cors[1:5] ['161:378', '334:3', '334:4', '65:436'] List 2: seq >>> seq[0:2] ['>probe:HG-U133A_2:1007_s_at:416:177; Interrogation_Position=3330; Antisense;', 'CACCCAGCTGGTCCTGTGGATGGGA'] A slow method: >>> sequences = [] >>> for elem1 in range_cors: for index,elem2 in enumerate(seq): if elem1 in elem2: sequences.append(elem2) sequences.append(seq[index+1]) This process is very slow and it is taking a lot of time. I am not happy. A faster method (probably): >>> for i in range(len(range_cors)): for index,m in enumerate(seq): pat = re.compile(i) if re.search(pat,seq[m]): p.append(seq[m]) p.append(seq[index+1]) I am getting errors, because I am trying to create an element as a pattern in re.compile(). Questions: 1. Is it possible to do this. If so, how can I do this. Can any one help correcting my piece of code and suggesting where I went wrong. Thank you in advance. -K __________________________________________________ Do You Yahoo!? Tired of spam? Yahoo! Mail has the best spam protection around http://mail.yahoo.com

4 5

How to put my functions in an array
by Mohamed Lrhazi Jan. 2, 2005

Jan. 2, 2005

def addvirt(): pass def remvirt(): pass PROVISION_ACTIONS=[('addvirt','Add Virt'),('remvirt','Remove Virt'),] formhandlers={} # this works formhandlers["addvirt"]=addvirt formhandlers["remvirt"]=remvirt # this does not work: for verb,verb_desc in PROVISION_ACTIONS: if callable(verb): formhandlers[verb]=verb I tried a few different syntaxes but to no avail... do I need things like: getattr()? Thanks alot Mohamed~

6 8

O.T.
by Jacob S. Jan. 2, 2005

Jan. 2, 2005

I hate to sound weird... But who are you all, what are you're ages, what do you do, marriage status, etc? You obviously don't have to answer, I'm just curious who I'm boldly sending emails to. Jacob Schmidt P.S. I'm a student. 14 years. Play the piano better than I write scripts. Single. etc.

22 26

Parsing a block of XML text
by kumar s Jan. 2, 2005

Jan. 2, 2005

Dear group: I am trying to parse BLAST output (Basic Local Alignment Search Tool, size around more than 250 KB ). - <Hit> <Hit_num>1</Hit_num> <Hit_id>gi|43442325|emb|BX956931.1|</Hit_id> <Hit_def>DKFZp781D1095_r1 781 (synonym: hlcc4) Homo sapiens cDNA clone DKFZp781D1095 5', mRNA sequence.</Hit_def> <Hit_accession>BX956931</Hit_accession> <Hit_len>693</Hit_len> - <Hit_hsps> - <Hsp> <Hsp_num>1</Hsp_num> <Hsp_bit-score>1164.13</Hsp_bit-score> <Hsp_score>587</Hsp_score> <Hsp_evalue>0</Hsp_evalue> <Hsp_query-from>1</Hsp_query-from> <Hsp_query-to>587</Hsp_query-to> <Hsp_hit-from>107</Hsp_hit-from> <Hsp_hit-to>693</Hsp_hit-to> <Hsp_query-frame>1</Hsp_query-frame> <Hsp_hit-frame>1</Hsp_hit-frame> <Hsp_identity>587</Hsp_identity> <Hsp_positive>587</Hsp_positive> <Hsp_align-len>587</Hsp_align-len> <Hsp_qseq>GGACCTCTCCAGAATCCGGATTGCTGAATCTTCCCTGTTGCCTAGAAGGGCTCCAAACCACCTCTTGACAATGGGAAACTGGGTGGTTAACCACTGGTTTTCAGTTTTGTTTCTGGTTGTTTGGTTAGGGCTGAATGTTTTCCTGTTTGTGGATGCCTTCCTGAAATATGAGAAGGCCGACAAATACTACTACACAAGAAAAATCCTTGGGTCAACATTGGCCTGTGCCCGAGCGTCTGCTCTCTGCTTGAATTTTAACAGCACGCTGATCCTGCTTCCTGTGTGTCGCAATCTGCTGTCCTTCCTGAGGGGCACCTGCTCATTTTGCAGCCGCACACTGAGAAAGCAATTGGATCACAACCTCACCTTCCACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTGTTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATTCTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCCCGAAACACGACAGTGGAGTATGTGACATTCACCAGCA</Hsp_qseq> <Hsp_hseq>GGACCTCTCCAGAATCCGGATTGCTGAATCTTCCCTGTTGCCTAGAAGGGCTCCAAACCACCTCTTGACAATGGGAAACTGGGTGGTTAACCACTGGTTTTCAGTTTTGTTTCTGGTTGTTTGGTTAGGGCTGAATGTTTTCCTGTTTGTGGATGCCTTCCTGAAATATGAGAAGGCCGACAAATACTACTACACAAGAAAAATCCTTGGGTCAACATTGGCCTGTGCCCGAGCGTCTGCTCTCTGCTTGAATTTTAACAGCACGCTGATCCTGCTTCCTGTGTGTCGCAATCTGCTGTCCTTCCTGAGGGGCACCTGCTCATTTTGCAGCCGCACACTGAGAAAGCAATTGGATCACAACCTCACCTTCCACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTGTTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATTCTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCCCGAAACACGACAGTGGAGTATGTGACATTCACCAGCA</Hsp_hseq> <Hsp_midline>|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||</Hsp_midline> </Hsp> </Hit_hsps> </Hit> - <Hit> I wanted to parse out : <Hsp_query-from> <Hsp_query-out) <Hsp_hit-from></Hsp_hit-from> <Hsp_hit-to></Hsp_hit-to> I wrote a ver small 4 line code to obtain it. for bls in doc.getElementsByTagName('Hsp_num'): bls.normalize() if bls.firstChild.data >1: print bls.firstChild.data This is not sufficient for me to get anything doen. Could any one help me directing how to get the elements in that tag. Thanks. -K __________________________________ Do you Yahoo!? Send holiday email and support a worthy cause. Do good. http://celebrity.mail.yahoo.com

2 3

Fwd: ASCII encoding for a £ sign
by David Holland Jan. 1, 2005

Jan. 1, 2005

Apologies, I did not see that Kent had already answered this ! Thanks Kent I put that encoding and it works fine. Although surprisingly the other idea :- write the string with '\xc2' did not work. --- David Holland <davholla2002(a)yahoo.co.uk> wrote: > Date: Fri, 31 Dec 2004 16:28:59 +0000 (GMT) > From: David Holland <davholla2002(a)yahoo.co.uk> > Subject: ASCII encoding for a £ sign > To: tutor(a)python.org > > I ran a program with a "£" sign, and I got this > message :- > > "sys:1: DeprecationWarning: Non-ASCII character > '\xc2' > in file birdgame32a.py on line 93, but no encoding > declared; see > http://www.python.org/peps/pep-0263.html > for details' > I looked at the message but I am not sure what > encoding to use for "£". > > > > > > ___________________________________________________________ > > ALL-NEW Yahoo! Messenger - all new features - even > more fun! http://uk.messenger.yahoo.com > ___________________________________________________________ ALL-NEW Yahoo! Messenger - all new features - even more fun! http://uk.messenger.yahoo.com

2 1

Re: [Tutor] cgi.FieldStorage and dictionary.get(' ')
by Patric Michael Dec. 31, 2004

Dec. 31, 2004

Forwarded to the list... > On Thu, 30 Dec 2004 22:58:14 -0800, Patric Michael <patric(a)usa.net> > wrote: > > First off, make sure that you have the "Content-Type: > text/html\n\n" > line print before anything else whenever you send > output to the web. > Presumably it worked for the form display, but > you have to keep resending it > each time the page changes. > > > Without seeing the def for login(failure), and not being familiar with > SQL, I'll take > a pass on these lines, but I am curious why you > declare failure as true or false in > the login function? > > Instead > of form.get(), try this: > > print form['author'].value > > print form['password'].value > > > Hi, > > def main(form): > if form.has_key('author') and form.has_key('password'): > author = form['author'].value > password = form['password'].value > q = Users.select(AND(Users.q.author==author, > Users.q.password==password)) > if len(list(q))>0: > chapters(author) > else: > login(failure=True) > else: > login(failure=False) > > Using form['author'].value works so long as it's assigned to a > variable before being looked up by sqlobject. This is interesting > because, if I try this from the interperter: > > >>> author = form['author'].value > Traceback (most recent call last): > File "<stdin>", line 1, in ? > AttributeError: 'str' object has no attribute 'value' Right. If I recall correctly, the .value method is specific to the cgi module since FieldStorage() is actually a bunch of dictionaries contained in a list. The .value method shortcuts the need to extract the dictionary from the list, then extract the key/value pair from the result and lets you grab the value directly. (Someone correct me if I misremember this, please!) > > I define login(failure) as True or False because the first time the > user reaches the login page they shouldn't be presented with a failure > message. The second time round they should. Oh cool. I hadnt thought of that. I usually use a try: statement to test for one of the keys to determine whether the script sends the initial login form, or the login form with appropriate error messages prepended. That way I can explicitly indicate which field(s) need attention. > > Everything happens through a driver script: > > #!/usr/local/bin/python > > print 'Content-type: text/html\n\n' > > import cgi > from spanishlabs.gui import * > > if __name__ == '__main__': > main(form=cgi.FieldStorage()) > > Thanks for your help! > No problem! Patric

1 0

Parsing a block of XML text
by kumar s Dec. 31, 2004

Dec. 31, 2004

Dear group: I am trying to parse BLAST output (Basic Local Alignment Search Tool, size around more than 250 KB ). - <Hit> <Hit_num>1</Hit_num> <Hit_id>gi|43442325|emb|BX956931.1|</Hit_id> <Hit_def>DKFZp781D1095_r1 781 (synonym: hlcc4) Homo sapiens cDNA clone DKFZp781D1095 5', mRNA sequence.</Hit_def> <Hit_accession>BX956931</Hit_accession> <Hit_len>693</Hit_len> - <Hit_hsps> - <Hsp> <Hsp_num>1</Hsp_num> <Hsp_bit-score>1164.13</Hsp_bit-score> <Hsp_score>587</Hsp_score> <Hsp_evalue>0</Hsp_evalue> <Hsp_query-from>1</Hsp_query-from> <Hsp_query-to>587</Hsp_query-to> <Hsp_hit-from>107</Hsp_hit-from> <Hsp_hit-to>693</Hsp_hit-to> <Hsp_query-frame>1</Hsp_query-frame> <Hsp_hit-frame>1</Hsp_hit-frame> <Hsp_identity>587</Hsp_identity> <Hsp_positive>587</Hsp_positive> <Hsp_align-len>587</Hsp_align-len> <Hsp_qseq>GGACCTCTCCAGAATCCGGATTGCTGAATCTTCCCTGTTGCCTAGAAGGGCTCCAAACCACCTCTTGACAATGGGAAACTGGGTGGTTAACCACTGGTTTTCAGTTTTGTTTCTGGTTGTTTGGTTAGGGCTGAATGTTTTCCTGTTTGTGGATGCCTTCCTGAAATATGAGAAGGCCGACAAATACTACTACACAAGAAAAATCCTTGGGTCAACATTGGCCTGTGCCCGAGCGTCTGCTCTCTGCTTGAATTTTAACAGCACGCTGATCCTGCTTCCTGTGTGTCGCAATCTGCTGTCCTTCCTGAGGGGCACCTGCTCATTTTGCAGCCGCACACTGAGAAAGCAATTGGATCACAACCTCACCTTCCACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTGTTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATTCTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCCCGAAACACGACAGTGGAGTATGTGACATTCACCAGCA</Hsp_qseq> <Hsp_hseq>GGACCTCTCCAGAATCCGGATTGCTGAATCTTCCCTGTTGCCTAGAAGGGCTCCAAACCACCTCTTGACAATGGGAAACTGGGTGGTTAACCACTGGTTTTCAGTTTTGTTTCTGGTTGTTTGGTTAGGGCTGAATGTTTTCCTGTTTGTGGATGCCTTCCTGAAATATGAGAAGGCCGACAAATACTACTACACAAGAAAAATCCTTGGGTCAACATTGGCCTGTGCCCGAGCGTCTGCTCTCTGCTTGAATTTTAACAGCACGCTGATCCTGCTTCCTGTGTGTCGCAATCTGCTGTCCTTCCTGAGGGGCACCTGCTCATTTTGCAGCCGCACACTGAGAAAGCAATTGGATCACAACCTCACCTTCCACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTGTTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATTCTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCCCGAAACACGACAGTGGAGTATGTGACATTCACCAGCA</Hsp_hseq> <Hsp_midline>|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||</Hsp_midline> </Hsp> </Hit_hsps> </Hit> - <Hit> I wanted to parse out : <Hsp_query-from> <Hsp_query-out) <Hsp_hit-from></Hsp_hit-from> <Hsp_hit-to></Hsp_hit-to> I wrote a ver small 4 line code to obtain it. for bls in doc.getElementsByTagName('Hsp_num'): bls.normalize() if bls.firstChild.data >1: print bls.firstChild.data This is not sufficient for me to get anything doen. Could any one help me directing how to get the elements in that tag. Thanks. -K __________________________________________________ Do You Yahoo!? Tired of spam? Yahoo! Mail has the best spam protection around http://mail.yahoo.com

1 0

ASCII encoding for a £ sign
by David Holland Dec. 31, 2004

Dec. 31, 2004

I ran a program with a "£" sign, and I got this message :- "sys:1: DeprecationWarning: Non-ASCII character '\xc2' in file birdgame32a.py on line 93, but no encoding declared; see http://www.python.org/peps/pep-0263.html for details' I looked at the message but I am not sure what encoding to use for "£". ___________________________________________________________ ALL-NEW Yahoo! Messenger - all new features - even more fun! http://uk.messenger.yahoo.com

1 0