🌐 Mailman 3 June 2006 - Tutor - python.org

ossaudiodev, pygtk, and flushing buffers
by Matthew White Aug. 3, 2007

Aug. 3, 2007

Hello All, I'm writing a little audio player that plays voicemail files. (I realize I'm reinventing the wheel, but it's still fun.) The problem I'm experiencing is that I'm hearing the last fraction of the sound clip twice, either when the clip is done playing or when the program exits. I've tried a few things and none of them have worked. The bit of code that does the playing is here: def play(self): if self.data_written < self.file_length: buf = self.data.read(self.buf_size) self.data_written += self.dsp.write(buf) self.percent_done = self.data_written / self.file_length if self.data_written == self.file_length: self._reopen_audio_device() This causes the second playing of the "last little bit" when the end of the file is reached. When I don't include the second if statement, the "last little bit" gets played when the program exits. According to the documentaiton, closing the audio device will flush any data in the sound card buffer. I guess what I'm hearing is that buffered clip being flushed. I've thought about using the mixer device to put the volume to zero, flush the buffer, then turning the volume back up again, but that seems like a hack. If anyone decides to use this program, you'll need to use a .wav file and change the value of self.sample_rate in vmPlayer.py from 8000 to 44100 (or whatever rate your file is encoded in) (Also, I plan on auto-detecting the sample rate in the future. I hard coded 8000 because that's the rate the voice mail system uses.) See attached files for the code. -mtw

3 3

Mod-python
by patricia July 5, 2006

July 5, 2006

Hi! I have about 17 lines of text (about system information) that I need to pass to a remote web server AND I've been asked to send this data via Apache. I have to write a python script that will fetch a URL to pass this text. I understand that if I want to use the POST method, I would need to have a page with a submit button, and this is not the case. I also know that with GET, the length of the url is limited. What is the best way to send a long string? Hope anyone can point me to the right direction.. Thanks, Patricia

12 20

saving output in a text file
by Hafsa raza June 30, 2006

June 30, 2006

2 2

Re: [Tutor] Unit testing
by Kent Johnson June 30, 2006

June 30, 2006

Tino Dai wrote: > And there is one caveat, I > will have to make a bunch of semaphores global instead of local to the > classes. While I know that there is no hard and fast rule about using > global variables, where can I find or can somebody tell me where I can > find some guidelines about them (or is this a use common sense rule)? Main guideline - don't use globals. Fallback rule - don't use globals. Third rule - OK, if you really can't think of any other way, make it a global. :-) Can you pass the semaphore to the class constructor (__init__() method)? What is it about the unit test that pushes you to make it global? Kent

5 9

Python urllib (linux)
by Patty June 30, 2006

June 30, 2006

Hi all, I'm doing some failure testing for a python script that uses urllib and urllib2 to open a web page and post data. If the server's apache is down or if I change the ip address the script is trying to contact to be a bogus address, the script handles it prefectly. When I unplug the ethernet cable from my machine (client), the script hangs. Is there a way I can implement a timeout to handle this problem? I'd appreciate any suggestions because I'm clueless. Thanks, Patty

3 3

Wiget
by ryan luna June 30, 2006

June 30, 2006

Hey everyone, im just learning to use Tkinter, and im trynig to write a "Guess my number" game program in widget forum but im having some problems, First heres the code im using, Button(self, text = "Sumit", command = self.number_anwser ).grid(row = 4, column = 0, sticky = W) self.response_txt = Text(self, width = 50, height = 5, wrap = WORD) self.response_txt.grid(row = 5, column = 0, columnspan = 4) def number_anwser(self): guess = self.guess_ent.get() guess = int(guess) response = "" tries = 1 if (guess < the_number): response += "Higher" tries += 1 elif (guess > the_number): response += "Lower" tries += 1 else: tries = str(tries) response += "Correct! that was my number, \n" response += "You guessed it in just " response += tries response += " tries!" self.response_txt.delete(0.0, END) self.response_txt.insert(0.0, response) the_number = random.randrange(100) + 1 root = Tk() root.title("Guess my number GUI") app = Application(root) root.mainloop() The problem is at the end where i try and get the number of Tries the user has tried it would just reset everytime the button in clicked, so my question is how would i go about getting the number of times the button is clicked and the anwser is wrong.

3 2

Variables don't change when altered within a loop?
by Evan Klitzke June 30, 2006

June 30, 2006

Hi, I just started picking up python yesterday, and have already come across something that has me stumped. I want some code that does this: a = foo(a) b = foo(b) c = foo(c) So I try to do this with a for loop, like so: for i in [a, b, c]: i = foo(i) print i # make sure that it worked correctly So far, so good. The problem is that outside the loop, the values aren't changed. For example, print [a, b, c] # outside the loop; the values never actually changed! What is going on? Why aren't the values of my variables changing when I change them inside a loop like this? -- Evan

3 3

Re: [Tutor] How to check a files size
by Kent Johnson June 29, 2006

June 29, 2006

> From: "John Fouhy" <john(a)fouhy.net> > > On 29/06/06, Kent Johnson <kent37(a)tds.net> wrote: > > See shutil.copyfile() > > Why isn't this function in the os module with the other file commands? I don't know why they are broken up in this way. The glob module also has some file access commands. J Orendorff's path module integrates them and makes a very useful wrapper around file functionality. I use it a lot: http://www.jorendorff.com/articles/python/path/index.html Kent

4 3

Splitting text
by Apparao Anakapalli June 29, 2006

June 29, 2006

hello all: I have a question and I do not know how I can work it out. I have a file of sequences >a TCCCTGCGGCGCATGAGTGACTGGCGTATTTAGCCCGTCACATTTA' >b CCTGCGGCGCATGAGTGACTGGCGTATTTAGCCCGTCACAATTTAA' .... (10 K) pattern = 'ATTTA' I want to find the pattern in the sequence and count. For instance in 'a' there are two 'ATTTA's. How can I do that. One approach tried: import re pat = 'ATTTA' if re.search(pat,a): print 'yes' By counting number of yeses I thought I can answer the question. However, the above approach only looks for the first instance of pat and says yes and moves to next. The other way: a.find(pat) This also looks for first one and reports the position of chracter. Could any one suggest the best way to cound the number of patterns. Thank you appu __________________________________________________ Do You Yahoo!? Tired of spam? Yahoo! Mail has the best spam protection around http://mail.yahoo.com

4 3

Re: [Tutor] classes and functions
by Mike Hansen June 29, 2006

June 29, 2006

> -----Original Message----- > From: tutor-bounces(a)python.org > [mailto:tutor-bounces@python.org] On Behalf Of anil maran > Sent: Thursday, June 29, 2006 12:51 PM > To: Tutor > Subject: [Tutor] classes and functions > > how to use classes and functions in python > thanks What do you need to know? Have you read the tutorial? http://pytut.infogami.com/ The tutorial wiki has some info about functions http://pytut.infogami.com/node6.html There's also some information on classes http://pytut.infogami.com/node11-baseline.html Post specific questions if these links aren't clear enough, and we can probably help. I hope these links help you. Mike http://users.adelphia.net/~mahansen/programming/

1 0